Sequence ID | >C181009228 |
Genome ID | CP010681 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Phaeobacter piscinae P14 [CP010681] |
Start position on genome | 3509830 |
End posion on genome | 3509905 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tgcaccagtc |
tRNA gene sequence |
GCCGCTGTAGCTCAGATGGTAGAGCACGTCATTCGTAATGATGGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
atttctcttt |
Secondary structure (Cloverleaf model) | >C181009228 Thr CGT c ACCA atttctcttt G - C C - G C - G G - C C - G T - A G - C T G T T T C C C A A G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |