Sequence ID | >C181010291 |
Genome ID | CP011028 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas espejiana DSM 9414 ATCC 29659 [CP011028, CP011029] |
Start position on genome | 3321443 |
End posion on genome | 3321367 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tataaaagtt |
tRNA gene sequence |
GGCCCCTTAGCTCAGTTGGTTAGAGCACACGACTCATAATCGTTAGGTCCCCAGTTCGAG |
Downstream region at tRNA end position |
cttttccaag |
Secondary structure (Cloverleaf model) | >C181010291 Met CAT t ACCA cttttccaag G - C G - C C - G C - G C - G C - G T - A T G T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A A AGGTC C T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |