Sequence ID | >C181021331 |
Genome ID | CP016782 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Candidatus Planktophila limnetica [CP016782] |
Start position on genome | 1078257 |
End posion on genome | 1078183 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tggaacttaa |
tRNA gene sequence |
GGGTGCTTAGCTCAGTGGTAGAGCGTCTCGTTTACACCGAGAATGTCGGGGGTTCGAAAC |
Downstream region at tRNA end position |
gggaaagaaa |
Secondary structure (Cloverleaf model) | >C181021331 Val TAC a ACCA gggaaagaaa G - C G - C G - C T + G G - C C - G T - A A A T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |