Sequence ID | >W141493515 |
Genome ID | JGDJ01000171 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides fragilis str. S36L11 [JGDJ] |
Start position on genome | 655 |
End posion on genome | 580 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaagtgtcac |
tRNA gene sequence |
GCCGCTATAGCTCAGTCGGTAGAGCAACGCATTCGTAACGCGTAGGTCGCCAGTTCAAGT |
Downstream region at tRNA end position |
aagcagaaac |
Secondary structure (Cloverleaf model) | >W141493515 Thr CGT c TCAA aagcagaaac G - C C - G C - G G - C C - G T - A A - T T G T C G G T C A T G A A | | | | | A C C T C G G C C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G G - C C - G A C T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |