Sequence ID | >C181027714 |
Genome ID | CP017713 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM DSM 20001 [CP017713] |
Start position on genome | 1391177 |
End posion on genome | 1391264 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
actttgttgt |
tRNA gene sequence |
GGAGAGTTGGCAGAGTGGTAATGCAACGGACTCGAAATCCGTCGAACCGGCTTATACCGG |
Downstream region at tRNA end position |
ataaattcta |
Secondary structure (Cloverleaf model) | >C181027714 Ser CGA t Ttaa ataaattcta G - C G - C A - T G - C A - T G - C T - A T A T T G T C C A G A G + | | | | A T G A C G G C A G G C G | | | T T G A T G C T A A CGAACCGGCTTATACCGGCGC A - T C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |