Sequence ID | >C181030447 |
Genome ID | CP018061 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus mundtii DSM 4838 [CP018061] |
Start position on genome | 2814953 |
End posion on genome | 2814879 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
taaaaacatT |
tRNA gene sequence |
GGTTCCGTGGTGTAGGGGTTAACATGCCTGCCTGTCACGCAGGAGATCGCGGGTTCGATT |
Downstream region at tRNA end position |
ggctcggtag |
Secondary structure (Cloverleaf model) | >C181030447 Asp GTC T GTtt ggctcggtag G - C G - C T - A T - A C - G C - G G - C T T T T G C C C A G G A G + | | | | G G T G T G G C G G G C G | | | + T T T A C A T T A G AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |