Sequence ID | >W141494232 |
Genome ID | JGDT01000017 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides fragilis str. 3-F-2 #6 [JGDT] |
Start position on genome | 125331 |
End posion on genome | 125404 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
taagtcacat |
tRNA gene sequence |
TGGGCTATGGTGTAATGGTAACACTACAGATTCTGGTCCTGTCATTTCTGGTTCGAGTCC |
Downstream region at tRNA end position |
attcacatta |
Secondary structure (Cloverleaf model) | >W141494232 Gln CTG t ACAA attcacatta T - A G - C G - C G - C C - G T - A A - T T G T A G A C C A A A G | | | | | G T T G T G T C T G G C G | | | | T T G A C A C T A T CATT A - T C - G A - T G - C A C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |