Sequence ID | >C181031478 |
Genome ID | CP018321 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alteromonas macleodii Te101 [CP018321] |
Start position on genome | 1229481 |
End posion on genome | 1229557 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acaagtttac |
tRNA gene sequence |
GCGTGTGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tattgaaaaa |
Secondary structure (Cloverleaf model) | >C181031478 Arg ACG c GCCA tattgaaaaa G - C C - G G - C T - A G - C T - A G - C T A T C T T C C A C G A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |