Sequence ID | >C181036666 |
Genome ID | CP019162 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. 13-15 [CP019162, CP019163] |
Start position on genome | 1226242 |
End posion on genome | 1226318 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cactcaatgt |
tRNA gene sequence |
CGGTATGTAGCGCAGCCTGGTAGCGCACTGTCATGGGGTGGCAGGGGTCGAGAGTTCGAA |
Downstream region at tRNA end position |
attaactccc |
Secondary structure (Cloverleaf model) | >C181036666 Pro GGG t ACCA attaactccc C - G G - C G - C T - A A - T T - A G - C T A T C T C T C A C G A A | | | | | G C C G C G G A G A G C T | | | | T T G G C G C G T A A GGGTC C - G T - A G - C T + G C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |