Sequence ID | >C181047557 |
Genome ID | CP020921 |
Search identical group | |
Phylum/Class | Thermodesulfobiota |
Species | Thermodesulfobium acidiphilum 3127-1 [CP020921] |
Start position on genome | 286258 |
End posion on genome | 286182 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tacaatctgt |
tRNA gene sequence |
GAGCCGTTAGCTCAGCCAGGTAGAGCATCGGCCTTTTAAGCCGAGGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
ttttttttat |
Secondary structure (Cloverleaf model) | >C181047557 Lys TTT t ACCA ttttttttat G - C A - T G - C C - G C - G G - C T - A G A T C T T C C A C G A A | | | | | G C C T C G G A A G G C A | | | | T T G G A G C G T A A GGGTC T - A C - G G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |