Sequence ID | >C181047606 |
Genome ID | CP020925 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium yanoikuyae SHJ [CP020925] |
Start position on genome | 3406500 |
End posion on genome | 3406424 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cctccacaac |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCATCAGACTACGAATCTGAGGGTCGGACGTTCGAA |
Downstream region at tRNA end position |
ttccttctca |
Secondary structure (Cloverleaf model) | >C181047606 Arg ACG c ACCA ttccttctca G - C C - G A - T C - G C - G C - G G - C T A T C T T G C A C G A A | + | | | G T C T C G G G A C G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |