Sequence ID | >C181048368 |
Genome ID | CP020989 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas citri pv. phaseoli var. fuscans CFBP6996R [CP020989] |
Start position on genome | 918629 |
End posion on genome | 918704 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gcagcaacgc |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
ctttagacat |
Secondary structure (Cloverleaf model) | >C181048368 Ala GGC c ACCA ctttagacat G - C G - C G + T G - C C - G C - G A - T C T T C C G C C A C G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |