Sequence ID | >C181050227 |
Genome ID | CP021257 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila subsp. fraseri Lansing 3 [CP021257] |
Start position on genome | 1324409 |
End posion on genome | 1324485 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ggacgggtat |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGGGTTCAAA |
Downstream region at tRNA end position |
tttaagcgcc |
Secondary structure (Cloverleaf model) | >C181050227 Pro TGG t ACCA tttaagcgcc C - G G - C G - C G - C G - C T T G - C T A T C T C C C A T G A A | + | | | A C C G C G G G G G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |