Sequence ID | >C181053241 |
Genome ID | CP021641 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Alcaligenes faecalis JQ135 [CP021641] |
Start position on genome | 3307164 |
End posion on genome | 3307090 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taaaagcttc |
tRNA gene sequence |
GGGCGGTTAACTCAGTGGTAGAGTGCCACCTTCACACGGTGGAAGTCACAAGTTCGAACC |
Downstream region at tRNA end position |
tctcttcctt |
Secondary structure (Cloverleaf model) | >C181053241 Val CAC c ACCA tctcttcctt G - C G - C G - C C - G G - C G - C T - A C A T T G T T C A G A A | | | | | G T C T C A A C A A G C G | | | | T T G G A G T T A G AAGTC C - G C - G A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |