Sequence ID | >C181058849 |
Genome ID | CP022123 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium polymorphum KCOM 1275 [CP022123] |
Start position on genome | 2459088 |
End posion on genome | 2459000 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggtaagttt |
tRNA gene sequence |
GGTGAGATGGCAGAGTGGCCTAATGCACTGACCTGCTAAGTCAGAGTACCGTTTCGGTAC |
Downstream region at tRNA end position |
taatatgaaa |
Secondary structure (Cloverleaf model) | >C181058849 Ser GCT t GCCA taatatgaaa G - C G - C T - A G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | A G G A C G G A G G G C G | | | T T C A T G C C T A A AGTACCGTTTCGGTACC C - G T - A G - C A - T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |