Sequence ID | >C181058880 |
Genome ID | CP022123 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium polymorphum KCOM 1275 [CP022123] |
Start position on genome | 1088657 |
End posion on genome | 1088581 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gtattattat |
tRNA gene sequence |
GCATCTGTGGCTCAATTGGATAGAGCATCTGACTACGGATCAGAGGGTTGTGGGTTCGAC |
Downstream region at tRNA end position |
gataaaatgc |
Secondary structure (Cloverleaf model) | >C181058880 Arg ACG t GCCA gataaaatgc G - C C - G A - T T + G C - G T - A G - C T C T C G T C C A T A A G | + + | | G T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |