| Sequence ID | >C181060628 |
| Genome ID | CP022203 |
| Phylum/Class | Myxococcota |
| Species | Corallococcus macrosporus DSM 14697 [CP022203] |
| Start position on genome | 3606179 |
| End posion on genome | 3606254 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ctcggcaatt |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGTGGGTTCGAGT |
| Downstream region at tRNA end position |
aatgttgtag |
| Secondary structure (Cloverleaf model) | >C181060628 Gly TCC
t TCCA aatgttgtag
G - C
C - G
G - C
G - C
G - C
A - T
A - T T G
T T A C C C A
T G A A + | | | | G
T C T C G G T G G G C
G | | | | T T
G G A G C
T A G ATGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |