Sequence ID | >C181060802 |
Genome ID | CP022207 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Francisella noatunensis [CP022207] |
Start position on genome | 428131 |
End posion on genome | 428206 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tttcaaaatc |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGGGGGTTCGAAC |
Downstream region at tRNA end position |
ctaaataaaa |
Secondary structure (Cloverleaf model) | >C181060802 Val TAC c ACCA ctaaataaaa G - C G - C G - C T - A G - C C - G T - A C A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |