| Sequence ID | >C181067691 |
| Genome ID | CP022528 |
| Phylum/Class | Alphaproteobacteria |
| Species | Qipengyuania flava VG1 [CP022528] |
| Start position on genome | 1861382 |
| End posion on genome | 1861306 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
aagtggctgc |
| tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGTGTCGGCCTGTCACGCCGAAGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
cttggggatt |
| Secondary structure (Cloverleaf model) | >C181067691 Asp GTC
c GCCA cttggggatt
G - C
C - G
G - C
G + T
G - C
T - A
G - C T G
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | + T T
G G A G T
T T A G AGGTC
T - A
C - G
G - C
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |