Sequence ID | >C181074499 |
Genome ID | CP022988 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactobacillus delbrueckii subsp. lactis DSM 20072 [CP022988] |
Start position on genome | 386865 |
End posion on genome | 386940 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acccgcttaT |
tRNA gene sequence |
GGGCCTGTAGCTCAGCTGGTTAGAGCGCACGCTTGATAAGCGTGAGGTCGATGGTTCAAG |
Downstream region at tRNA end position |
gagtaatact |
Secondary structure (Cloverleaf model) | >C181074499 Ile GAT T ATtg gagtaatact G - C G - C G - C C - G C - G T - A G - C T G T C T A C C A C G A A | | | | | A T C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |