Sequence ID | >C181077451 |
Genome ID | CP023197 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium breve NRBB49 [CP023197] |
Start position on genome | 1216676 |
End posion on genome | 1216749 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gattgatttc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGCTAGCGCACTTCGTTCACACCGAAGGGGTCGTAGGTTCGATT |
Downstream region at tRNA end position |
gaatccgctt |
Secondary structure (Cloverleaf model) | >C181077451 Val CAC c ACtg gaatccgctt G - C G - C G - C C - G G - C A - T T - A T T T C A T C C A C G A G | | | | | G G C G C G G T A G G C G | | | | T T C G C G C T A A GGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |