Sequence ID | >C181084404 |
Genome ID | CP023548 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhodobacter sp. CZR27 [CP023548] |
Start position on genome | 1725613 |
End posion on genome | 1725687 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccgcgccatc |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGTAGAGCGCTTCGTTCACATCGAAGATGTCAGCGGTTCAAATC |
Downstream region at tRNA end position |
tgacacgaaa |
Secondary structure (Cloverleaf model) | >C181084404 Val CAC c ACCA tgacacgaaa G - C G - C G - C C - G G - C A - T T - A T A T T T G C C A G A A | + | | | A C C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |