Sequence ID | >C181104959 |
Genome ID | CP024735 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella intermedia KCOM 1944 [CP024734, CP024735] |
Start position on genome | 100252 |
End posion on genome | 100181 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aaatctacaa |
tRNA gene sequence |
GCGGAATTAGCACATCGGTAGTGCACGGGCTTCCCAAGCCTGGGAGGCGGGTTCGACTCC |
Downstream region at tRNA end position |
cctcccacct |
Secondary structure (Cloverleaf model) | >C181104959 Gly CCC a TCtt cctcccacct G - C C - G G - C G - C A - T A - T T - A T C T T G C C C A T A A + | | | | G C C A C G G C G G G C G | | | | T T G G T G C T A A GGAG C - G G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |