Sequence ID | >C181108654 |
Genome ID | CP024923 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas psychrotolerans Cra20 [CP024923] |
Start position on genome | 1055018 |
End posion on genome | 1054945 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctcgcttcga |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTGACGTAGAGGACTGCAAATCCTCGCACCCGGGTTCGATTCC |
Downstream region at tRNA end position |
gcttctcgac |
Secondary structure (Cloverleaf model) | >C181108654 Cys GCA a TCCA gcttctcgac G - C G - C C - G C - G C - G G - C A - T T T T G G C C C A G A G | | | | | G T G G C G C C G G G C G | | + T T G A C G T T G A GCAC G - C A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |