Sequence ID | >C181118499 |
Genome ID | CP025534 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium glutamicum HA [CP025534] |
Start position on genome | 3211088 |
End posion on genome | 3211012 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgcagcggta |
tRNA gene sequence |
GGGGCTATAGCTCAGTCGGTTAGAGCCGTGGACTCATAATCCATTGGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
atattgaatg |
Secondary structure (Cloverleaf model) | >C181118499 Met CAT a ACCA atattgaatg G - C G - C G - C G - C C - G T + G A - T C G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C T T A C TGGTC G + T T - A G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |