| Sequence ID | >C181120825 |
| Genome ID | CP025618 |
| Phylum/Class | Gammaproteobacteria |
| Species | Acinetobacter schindleri SGAir0122 [CP025618] |
| Start position on genome | 647889 |
| End posion on genome | 647813 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
ttgtgtaagt |
| tRNA gene sequence |
GCAGCGGTAGTTCAGTTGGTTAGAATACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
tttacatgat |
| Secondary structure (Cloverleaf model) | >C181120825 Asp GTC
t GCCA tttacatgat
G - C
C - G
A - T
G - C
C - G
G - C
G - C T G
T T G C C C A
T G A A + | | | | G
T C T T G G C G G G C
G | | | + T T
G G A A T
T T A A GGGTC
C - G
C - G
G - C
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |