Sequence ID | >C181123138 |
Genome ID | CP025799 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Dickeya zeae MS2 [CP025799] |
Start position on genome | 252688 |
End posion on genome | 252762 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttccaggat |
tRNA gene sequence |
GCGGGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
attagatgtg |
Secondary structure (Cloverleaf model) | >C181123138 Gly TCC t TCCA attagatgtg G - C C - G G - C G - C G - C C - G A - T T T T C A C C C A T A A C | | | | | G G T A T G G T G G G C G | | | T T C T T A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |