Sequence ID | >C181123610 |
Genome ID | CP025930 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Porphyromonas gingivalis ATCC 33277 [CP025930] |
Start position on genome | 1094888 |
End posion on genome | 1094802 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggtgcggtaT |
tRNA gene sequence |
GCGGCTGTGGTGTAATTGGTAGCCACGCCAGACTTAGGATCTGGTGCTTCACGGCGTGCG |
Downstream region at tRNA end position |
Aaaaagaaga |
Secondary structure (Cloverleaf model) | >C181123610 Leu TAG T ACCC Aaaaagaaga G - C C - G G - C G - C C - G T - A G - C T G T C G C T C A T A A G | | | | | G T T G T G G C G A G C G | | | T T G C C A C T A G G TGCTTCACGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |