Sequence ID | >C181124576 |
Genome ID | CP025959 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus qingshengii djl-6-2 [CP025959] |
Start position on genome | 1836458 |
End posion on genome | 1836531 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgacaccga |
tRNA gene sequence |
GGCGGTGTAGCTCAGTTGGTAGAGCAAACGACTCATAATCGTTGCGTCGCCGGTTCAAGT |
Downstream region at tRNA end position |
aatatgcatg |
Secondary structure (Cloverleaf model) | >C181124576 Met CAT a ACac aatatgcatg G + T G - C C - G G - C G - C T - A G - C T G T T G G C C A T G A A + | | | | A T C T C G G C C G G C G | | | | T T G G A G C T A A GCGTC A - T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |