Sequence ID | >C181127924 |
Genome ID | CP026105 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Paraburkholderia hospita DSM 17164 [CP026105, CP026106, CP026107, CP026108, CP026109] |
Start position on genome | 806480 |
End posion on genome | 806570 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
caaagaatct |
tRNA gene sequence |
GGAAAGGTGGCAGAGTGGTCGAATGCGCCGGACTCGAAATCCGGTGTACAGTTATGCTGT |
Downstream region at tRNA end position |
gatgcaaagc |
Secondary structure (Cloverleaf model) | >C181127924 Ser CGA t GCCA gatgcaaagc G - C G - C A - T A - T A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C C G A G TGTACAGTTATGCTGTACC C - G C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |