Sequence ID | >C181130796 |
Genome ID | CP026328 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus caldus MTH-04 [CP026328] |
Start position on genome | 517870 |
End posion on genome | 517943 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cttcggtcgt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACCTCAGCCTTCCAAGCTGATGGTGTGGGTTCGATTCC |
Downstream region at tRNA end position |
agtacaggcc |
Secondary structure (Cloverleaf model) | >C181130796 Gly TCC t TCCA agtacaggcc G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A C TGGT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |