Sequence ID | >C181130811 |
Genome ID | CP026328 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus caldus MTH-04 [CP026328] |
Start position on genome | 1816611 |
End posion on genome | 1816687 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tggtgtccgg |
tRNA gene sequence |
GCGCCCATAGCTCAACCGGATAGAGCAACGGCCTTCTAAGCCGTAGGTTGCAGGTTCGAT |
Downstream region at tRNA end position |
atcaaaacag |
Secondary structure (Cloverleaf model) | >C181130811 Arg TCT g GCCA atcaaaacag G - C C - G G - C C - G C - G C - G A - T T T T C G T C C A C A A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTT A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |