Sequence ID | >C181137773 |
Genome ID | CP026681 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. 'Peltigera membranacea cyanobiont' N6 [CP026681] |
Start position on genome | 862185 |
End posion on genome | 862113 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aattgtttaa |
tRNA gene sequence |
TGCCGGGTGGACGAATTGGTAAGTCGCATCGCTCTGAACGATGAGGTTGCAGGTTCAAAC |
Downstream region at tRNA end position |
agccctgtgg |
Secondary structure (Cloverleaf model) | >C181137773 Gln CTG a Ataa agccctgtgg T - A G - C C - G C - G G + T G - C G - C C A T C G T C C A T A A G | | | | | A T G C A G G C A G G C G | | | T T G A G T C T A G AGGTT C - G A - T T - A C - G G - C C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |