Sequence ID | >C181144782 |
Genome ID | CP027001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium camporealensis CIP 105508 [CP027001] |
Start position on genome | 149356 |
End posion on genome | 149268 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtttcttctc |
tRNA gene sequence |
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGGTTCACGCCCCT |
Downstream region at tRNA end position |
aggagaaagc |
Secondary structure (Cloverleaf model) | >C181144782 Ser GGA c GCCA aggagaaagc G - C G - C A - T G - C G - C A - T T - A T A T C A C C C A C G A C | | | | | A G T C A G G T G G G C G | | | T T C T G T C C T A A CGGGGTTCACGCCCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |