Sequence ID | >C181146684 |
Genome ID | CP027188 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Idiomarina sp. OT37-5b [CP027188] |
Start position on genome | 252005 |
End posion on genome | 252079 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaatagttca |
tRNA gene sequence |
GCGGGTGTCGTATAGTGGCTATTACCTCAGCCTTCCAAGCTGATGACGCGGGTTCGATTC |
Downstream region at tRNA end position |
agctacaatc |
Secondary structure (Cloverleaf model) | >C181146684 Gly TCC a TCCA agctacaatc G - C C - G G - C G - C G - C T - A G - C T T T C G C C C A T G A C | | | | | G G T A T G G C G G G C G | | | T T C T T A C T A C TGAC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |