Sequence ID | >C181147747 |
Genome ID | CP027224 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lysinibacillus sp. B2A1 [CP027224] |
Start position on genome | 4262912 |
End posion on genome | 4262820 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atattgttac |
tRNA gene sequence |
GGAGGTATACCCAAGTCTGGCTGAAGGGATCGGTCTTGAAAACCGACAGGCGGGTAACAC |
Downstream region at tRNA end position |
gtttatttaa |
Secondary structure (Cloverleaf model) | >C181147747 Ser TGA c TCCA gtttatttaa G - C G - C A - T G - C G - C T - A A - T T A T C T C C C A C T G A A | + | | | G T A C C C G G G G G C G | | | T T G A G G G C T G A A CAGGCGGGTAACACCGCGC T - A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |