| Sequence ID | >C181147884 |
| Genome ID | CP027227 |
| Phylum/Class | Lentisphaerota |
| Species | Victivallales bacterium CCUG 44730 [CP027227] |
| Start position on genome | 1004765 |
| End posion on genome | 1004854 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
cggtgcaagc |
| tRNA gene sequence |
GGAGAGATGGCTGAGCGGTCGAAGGCGGCGGTCTCGAAAATCGCTGTACGGGCAACCGTA |
| Downstream region at tRNA end position |
tttttgtttt |
| Secondary structure (Cloverleaf model) | >C181147884 Ser CGA
c GCCA tttttgtttt
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
C G A G | | | | | G
G G T C G G A G G G C
G + | | T T
T A G G C
C G A G TGTACGGGCAACCGTACC
G - C
C - G
G - C
G + T
T - A
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |