| Sequence ID | >C181147915 |
| Genome ID | CP027227 |
| Phylum/Class | Lentisphaerota |
| Species | Victivallales bacterium CCUG 44730 [CP027227] |
| Start position on genome | 2910021 |
| End posion on genome | 2909945 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tttcataatt |
| tRNA gene sequence |
GGCGGCTTAGCTCAGTTGGTTAGAGCGTCGGAATCATAATCCGCAGGTCCCTGGTTCGAA |
| Downstream region at tRNA end position |
ttttttcctc |
| Secondary structure (Cloverleaf model) | >C181147915 Met CAT
t ACCA ttttttcctc
G + T
G - C
C - G
G - C
G - C
C - G
T - A T A
T G G T C C A
T G A A | | | | G
T C T C G C C T G G C
G | | | | T T
G G A G C
T T A G AGGTC
T C
C - G
G - C
G - C
A - T
A A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |