| Sequence ID | >C181147922 |
| Genome ID | CP027227 |
| Phylum/Class | Lentisphaerota |
| Species | Victivallales bacterium CCUG 44730 [CP027227] |
| Start position on genome | 2342365 |
| End posion on genome | 2342290 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
taaaaatcga |
| tRNA gene sequence |
GGGGTCGTAGCTCAACGGCTAGAGCACCTGCTTTGCAAGCAGGATGTTGAGGGTTCGAGT |
| Downstream region at tRNA end position |
gaacttctgg |
| Secondary structure (Cloverleaf model) | >C181147922 Ala TGC
a ACCA gaacttctgg
G - C
G - C
G + T
G - C
T - A
C - G
G - C T G
T T T C C C A
C A A A + | | | | G
G C T C G G A G G G C
G | | | | T T
C G A G C
T A A ATGTT
C - G
C - G
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |