Sequence ID | >C181148013 |
Genome ID | CP027229 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga sp. oral taxon 878 F0545 [CP027229] |
Start position on genome | 2102792 |
End posion on genome | 2102717 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aataaagatG |
tRNA gene sequence |
GTGGTTTTAGCTCAGTTGGTTAGAGCGTCGGATTGTGGTTCCGAAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
tattagaacc |
Secondary structure (Cloverleaf model) | >C181148013 His GTG G CCta tattagaacc G - C T - A G - C G - C T T T T T - A C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |