Sequence ID | >W09112112 |
Genome ID | ABXM01000013 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Ruegeria sp. R11 [ABXM] |
Start position on genome | 202405 |
End posion on genome | 202330 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcctcaggtc |
tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCACGTCATTCGTAATGATGGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
ctcttctccg |
Secondary structure (Cloverleaf model) | >W09112112 Thr CGT c ACCA ctcttctccg G - C C - G C - G G - C C - G T - A G - C T G T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |