Sequence ID | >C181156468 |
Genome ID | CP027569 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megasphaera elsdenii NCIMB702410 [CP027569] |
Start position on genome | 720712 |
End posion on genome | 720627 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tacctatcat |
tRNA gene sequence |
GCGGTTGTGGCGGAATGGCAGACGCGCTACTTTGAGGGGGTAGTGAGCGAAAGCTCATGG |
Downstream region at tRNA end position |
tagcttctca |
Secondary structure (Cloverleaf model) | >C181156468 Leu GAG t ACCA tagcttctca G - C C - G G - C G - C T - A T - A G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGAGCGAAAGCTCAT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |