Sequence ID | >C181160037 |
Genome ID | CP027793 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Prescottella equi DSSKP-R-001 [CP027793] |
Start position on genome | 3536769 |
End posion on genome | 3536694 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gcaagttctc |
tRNA gene sequence |
GGCCCCGTCGTCTAGCGGCCTAGGACGCCGCCCTCTCAAGGCGGTAGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
cggacagacc |
Secondary structure (Cloverleaf model) | >C181160037 Glu CTC c ACCA cggacagacc G + T G - C C - G C - G C - G C - G G - C T A T T G C C C A C G A C + | | | | G G T C T G G C G G G C G + | | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |