Sequence ID | >C181176729 |
Genome ID | CP029329 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium beijerinckii [CP029329] |
Start position on genome | 1394129 |
End posion on genome | 1394205 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaataatat |
tRNA gene sequence |
GCGTTTTTAGCTCAGTTGGATAGAGCAACGCCCTTCTAAGGCGTGGGCCGGGGGTTCGAA |
Downstream region at tRNA end position |
tatggtggat |
Secondary structure (Cloverleaf model) | >C181176729 Arg TCT t ACCA tatggtggat G - C C - G G - C T - A T - A T - A T - A T A T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |