Sequence ID | >C181176831 |
Genome ID | CP029331 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Thauera hydrothermalis GD-2 [CP029331] |
Start position on genome | 87380 |
End posion on genome | 87305 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
cgacagatgc |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCAGTTGACTCTTAATCAATTGGTCCTAGGTTCGAGT |
Downstream region at tRNA end position |
gcaaattcaa |
Secondary structure (Cloverleaf model) | >C181176831 Lys CTT c ACCA gcaaattcaa G - C G - C G - C G - C G - C T + G A - T T G T G A T C C A T G A A | | | | | G T C T C G C T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |