Sequence ID | >C181177152 |
Genome ID | CP029343 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Massilia oculi CCUG 43427 [CP029343] |
Start position on genome | 2234471 |
End posion on genome | 2234396 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gacctcaaat |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
aaaaagttca |
Secondary structure (Cloverleaf model) | >C181177152 Ala TGC t ACCA aaaaagttca G - C G - C G + T G - C G - C A - T T - A C T T C T G C C A C G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |