Sequence ID | >C181187762 |
Genome ID | CP030092 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Massilia sp. YMA4 [CP030092] |
Start position on genome | 4443269 |
End posion on genome | 4443193 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gtatgaacgc |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCACCGTGTTGATAACGCGGGGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
tcgtatcgca |
Secondary structure (Cloverleaf model) | >C181187762 Ile GAT c ACCA tcgtatcgca G - C G - C G - C T - A C - G T - A G - C C G T C A A C C A C G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C T + G G - C T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |