Sequence ID | >C181195173 |
Genome ID | CP031088 |
Search identical group | |
Phylum/Class | Mycoplasmatota |
Species | Spiroplasma phoeniceum P40 [CP031088] |
Start position on genome | 1443366 |
End posion on genome | 1443291 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgccaatcgt |
tRNA gene sequence |
GGTTCAGTAGCTCAGTTGGTAGAGCATTTGATTGAAGCTCAAAGTGTCGGCAGTTCAATT |
Downstream region at tRNA end position |
ttgaatttag |
Secondary structure (Cloverleaf model) | >C181195173 Phe GAA t ACCA ttgaatttag G - C G - C T - A T - A C - G A - T G - C T T T C T G T C A T G A A | + | | | A T C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC T - A T - A T - A G - C A - T T C T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |