Sequence ID | >C181196594 |
Genome ID | CP031192 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Humibacter sp. BT305 [CP031192] |
Start position on genome | 2413154 |
End posion on genome | 2413228 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgtcacaccc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGTAGCGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
cgacgacgaa |
Secondary structure (Cloverleaf model) | >C181196594 Val GAC c ACCA cgacgacgaa G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A G | | | | | G C C G C G A C T G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |