Sequence ID | >WENV021828 |
Genome ID | AACY020600387 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 185 |
End posion on genome | 111 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cagcgcaagc |
tRNA gene sequence |
GGGCGATTAGCACAGCGGTAGCGCACTTCCTTCACACGGAAGGGGTCACTGGTTCGAATC |
Downstream region at tRNA end position |
tgaatcgaca |
Secondary structure (Cloverleaf model) | >WENV021828 Val CAC c ATCT tgaatcgaca G - C G - C G - C C - G G - C A - T T - A T A T T G A C C A G A A | | | | | G C C A C G A C T G G C G | | | T T G G C G C T A A GGGTC C - G T - A T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |